A Mutation in the SLC45A2 Gene is Associated with Albinism in a Lhasa Apso Dog, HR Wijesena, SM Schmutz

Tags: Lhasa Apso, PCR-RFLP, causative mutation, albino Pug, Shar Pei, included dogs, Materials and Methods, cDNA, DNA Extraction, albinism, Pigment Cell, Lhasa Apsos, colored dogs, albino Doberman Pinschers, oculocutaneous albinism, Siberian Husky, exon, cDNA sequence, cause of albinism, albino, amino acid, Lhasa Apso Lhasa Apso Lhasa Apso Lhasa Apso Lhasa Apso Shar Pei Shar Pei Shar Pei Pekingese, Chin Chow Chow Chow Chow, red and white, Genomic DNA, CT Black, Afghan Hound, Japanese Chin, Chow Chow
Content: Proceedings, 10th World Congress of Genetics Applied to livestock production A Mutation in the SLC45A2 Gene is Associated with Albinism in a Lhasa Apso Dog H. R. Wijesena, S. M. Schmutz Department of Animal and Poultry Science, University of Saskatchewan, Saskatoon, Canada.
ABSTRACT: Mutations in Solute Carrier Family 45, member 2 gene (SLC45A2) have previously been reported to cause albinism in humans, mice, and horses. The objective of this study was to determine if a mutation in the SLC45A2 gene caused albinism in a Lhasa Apso. The study reveals a novel mutation in the seventh exon, a c.1479G>A base change that leads to an amino acid change G493A. This amino acid was conserved as a glycine in All Other domesticated species. This mutation was not found in any of the 30 other dogs of related breeds, all of whom were colored. The albino female Lhasa Apso was mated to a colored male and their four colored pups were all heterozygous for this mutation, suggesting that her albinism was due to a recessive 493A allele. Keywords: albino, MATP, oculocutaneous albinism, OCA Pug Introduction Mutations in the Solute Carrier Family 45, member 2 gene (SLC45A2), formerly called the MembraneAssociated Transporter Protein gene (MATP), are responsible for causing albinism in several species including humans (Newton et al. (2001)), mouse (Du and Fisher (2002)), horse (Mariat et al. (2003)) and dogs of the Doberman Pinscher breed (Winkler et al. (2013)). In humans, about 42 mutations have been identified in the SLC45A2 gene associated with oculocutaneous type 4 (OCA4) albinism and 7 of those mutations were found to be located in exon 7 in the Albinism Database (Oetting W. (2009)). Mariat et al. (2003) suggested that a mutation in exon 2 causes the palamino phenotype in horses. Recently, a very large deletion that includes exon 7 was reported as associated with the type of albinism found in Doberman Pinscher dogs (Winkler et al. (2013)). In addition to these findings, there is evidence for SLC45A2 gene mutations associated with albinism in lower vertebrates such as medaka (Fukamachi et al. (2001)) and chicken and Japanese quail (Gunnarsson et al. (2006)). Kushimoto et al. (2003) suggested that SLC45A2 is a transporter type gene with 12 transmembrane domains. Mutations in this gene have been shown to disrupt the trafficking of tyrosinase (TYR), TYRP1 and TYRP2, which are the rate limiting enzymes in melanin biosynthesis (Hearing (2005)) from the trans-golgi network to the melanosome. Since tyrosinase and the tyrosinase-related proteins, TYRP1 and TYRP2, are involved in the production of melanin pigments (Wakamatsu et al. (2002); Kushimoto et al. (2003)), it fits that misrouted enzymes cannot perform their assigned tasks in the melanosomes, ultimately leading to conditions such as albinism.
The objective of the present study was to examine the SLC452 gene of an albino Lhasa Apso for a possible causative mutation.
MATERIALS AND METHODS
Dogs. cDNA was available from the albino Lhasa Apso dog. genomic DNA from 17 other Lhasa Apso dogs, including the affected dog's four puppies was used in the study, and an albino Pug. In addition, 30 dogs from 10 other related breeds (Parker et al. (2004)) including Pekingese (2), Japanese Chin (5), Chow Chow (2), Shar Pei (3), Akita (2), Saluki (3), Afghan Hound (4), Siberian Husky (5), Alaskan Malamute (3) and Samoyed (1) were also studied. These included dogs that were colored and white, but not albino.
Amplification and Sequencing of cDNA. The entire SLC452 coding region with seven exons was amplified in four parts using new and previously designed primers (Table 1). Exons 3 to 7 were amplified using cDNA from the albino Lhasa Apso. Since there was a limited amount of cDNA from this dog, Exon 1 and 2 were amplified using genomic DNA from one of her puppies. The PCR reactions were carried out using standard procedures. The PCR products were excised from the agarose gel and extracted using the Omega Biotech Gel Extraction Kit protocol and were sequenced on an Applied Biosystems Sequencer.
Table 1. Primers used to amplify the SLC45A2 coding sequence.
Region
Primers
Amplified Exon
Part 1 Part 2 Part 3 Part 4 P250L G493A
5'GACCATCTCTGTTGGCTGCTCAG 3' 3' GCCCACCTGTACAGACCACT 5' 5' TAGCAGTCACCTCCCATTCC 3' 3' GCCCACCTGTACAGACCACT 5' 5' CATTAAAGCCTACTTATTTG 3' 3' GATGCACAAGCCCCAACAT 5' 5' GTGCACACAACTCCACAGAG 3' 3'GTAGGGACAGTGTCTCTTTATTG 5' 5'CGCCTTGGTGCTTACTTTGT 3' 3'AATCCTGGGGTGCTTGCTGTGCG 5' 5' TTGTGGCAGGTAGGAAAAGC 3' 3'GTAGGGACAGTGTCTCTTTATTG 5'
1 2 3,4 5,6,7 3 7
Sequencing and PCR-RFLP. Genomic DNA was extracted following the protocol in the Epicentre BuccalAmp DNA extraction Kit. Forward and reverse primers were designed (Table 1) to amplify the SNP in exon 7. All 48 samples were amplified and sequenced for this SNP. A PCR-RFLP was designed to detect the SNP in exon 3. Since there were no natural restriction enzyme cut sites at this mutation, a purposeful mismatch primer was designed to create a cut site for the AciI enzyme (Table 1). The C allele was cleaved into two fragments (84bp and 20 bp) and the T allele remained uncut (104bp). Results and Discussion Although C. C. Little (1957) reported that albinism was rare in dogs, it does occur. A female Lhasa Apso exhibited the classical phenotype of oculocutaneous albinism. Her coat was white and her eyes, nose leather, paw pads and lips were pink. She had no visible pigmented tissue (Figure 1).
exon 4 (c.1023C>T), exon 6 (c.1363G>A) and exon 7 (c.1479G>A). The two SNPs in exons 4 and 6 did not cause amino acid changes, and therefore were regarded as silent variants. In contrast, the c.749C>T SNP in exon 3 resulted in a proline to leucine change (P250L) and the c.1479G>A SNP in exon 7 resulted in a glycine to asparatic acid change (G493D). Therefore only the later two SNPs were selected for further investigation in this study. A PCR-RFLP was designed to detect the c.P250L variant. Thirty three dogs of various breeds and colors were examined (Table 2). Both homozygous genotypes were observed in dogs that were not albino, ruling out this variant as the cause of albinism. This appears to be a neutral variant that does not have any phenotypic effect on coat color. The Lhasa Apso is considered an ancient breed (Parker et al. 2004). Genomic sequence for exon 7 was obtained from 30 additional dogs of 10 breeds that were also classified as "ancient". All of these dogs were homozygous for the 493G allele, whereas the albino Lhasa Apso was homozygous for the 493D allele. As expected, the four colored pups of this albino dam were heterozygous. This helps confirm that the oculocutaneous albinism of this Lhasa Apso is inherited as an autosomal recessive condition. An amino acid alignment shows that the glycine is conserved across all species at amino acid 493 (Figure 2). A topology prediction by TMHMM (v. 2.0; http://www.cbs.dtu.dk/services/ TMHMM-2.0/) shows that amino acid 493 is located in the eleventh transmembrane domain. The results for SLC45A2 in the albino Lhasa Apso suggest this domain would have an altered structure.
Figure 1. Photograph of an albino Lhasa Apso dog Schmutz and Berryere (2007) have previously shown that this particular albino Lhasa Apso did not show any mutations in the coding sequence of her Tyrosinase gene. TYR is associated with albinism in cats (Imes et al. (2006)), rats (Blaszczyk et al. (2005)) and OCA1 albinism in humans (Newton et al. (2001)), etc. Further she did not have the large deletion in SLC45A2 reported by Winkler et al. (2013) that was associated with albinism in Doberman Pinschers. Therefore attempts to obtain the entire coding sequence from the albino Lhasa Apso were made to search for other potential variants in the SLC45A2. The cDNA sequence from the albino Lhasa Apso was compared to previous cDNA sequence obtained from a cream Poodle (GenBank DQ302162), a Black and White Large Munsterlander and a red and white Brittany Spaniel. The three previous dogs all had identical sequence. However, the albino Lhasa Apso was homozygous for four single nucleotide polymorphisms in exon 3 (c.749C>T),
Figure 2. Amino acid alignment for the region around SLC45A2 G493D. The albino Pug did not have the 493D allele, but was homozygous for the 493G allele, as were all 30 other colored dogs. Likewise it did not have the deletion observed by Winkler et al. (2013) in the albino Doberman Pinschers.
Conclusion Based on PCR-RFLP results, we were able to exclude the P250L variant as the causative mutation for albinism in the Lhasa Apso. In contrast, the 493D allele was only homozygous in the albino Lhasa and heterozygous in her colored puppies. This provides evidence that this might be the mutation that caused albinism in the affected dog. Further it is very likely that this mutation arose in Lhasa Apsos, since the albino Pug did not carry this mutation. This research further shows that there are multiple forms of oculocutaneous albinism in dogs, at least two forms of which are caused by mutations in the SLC45A2 gene. Literature Cited Blaszcyk, W.M., Arning, L., Hoffmann, K.P. et al. (2005). Pigment Cell Res. 18:144-145. Du, J., and. Fisher, D. E. (2002). J. Biol. Chem. 277: 402406. Fukamachi, S., Shimada, A. and Shima, A. (2001). Nat. Genet. 28: 381-385. Gunnarsson, U., Hellstrom, A.R., Boichard, M.T. et al. (2006). Genetics 175:867-877. Hearing, V. J. (2005). Science 37:3-14. Imes, D.L., Geary, L.A., Grahan, R.A. et al. (2006). Anim. Genet, 37:175-178. Kushimoto, T., Valencia, J. C. V., Costin, G.E. et al. (2003). Pigment Cell Res. 16:237-244. Little, C. C. 1957. "The Inheritance of Coat Color in Dogs", Howell Book House, Ithaca, NY. Mariat, D., Taourit, S. and Guerin, G. (2003). Genet. Sel. Evol. 35:119-133. Newton, J. M., Cohen, O., Barak, N. et al. (2001). Am. J. Hum. Genet. 69:981-988. Oetting, W. Albinism Database (2009). http://www.ifpcs.org/albinism/ Viewed on 20 Feb 2013. Parker, H.G., Kim, L.V., Sutter, N.B. et al. (2004). Science 304:1160-1164. Schmutz, S.M. and Berryere, T. G. (2007). J. Heredity. 98:544-548. Wakamatsu, K., and Ito, S. (2002). Pigment Cell Res. 15:174-183. Winkler, P.A., Ramsey, D.T.,Venta, P.J. et al. (2013).7th International Conference on Advances in Canine and Feline Genomics and Inherited Diseases, Cambridge, MAssachusetts. 26 Sep 2013.
Table 2. PCR-RFLP results for the c.P250L variant.
ID
Breed
Tomu Pemo Ponya Mocha Tea Parti ChiLi Chine Sugar Antonio Nancy Ruby Tink Lily Baby Misty Merlin Cico Shelby Kaspar Zia Frank Lyla Sizzles Tiko Kaschmir Zara Anestasia Nola Tobin Ginny Mitzi Wampa Ms.Vicki
Lhasa Apso Lhasa Apso Lhasa Apso Lhasa Apso Lhasa Apso Shar Pei Shar Pei Shar Pei Pekingese Pekingese Japanese Chin Japanese Chin Japanese Chin Japanese Chin Chow Chow Chow Chow Siberian Husky Siberian Husky Saluki Saluki Saluki Malamute Malamute Malamute Afghan Hound Afghan Hound Afghan Hound Afghan Hound Akita Akita Samoyed West Highland White Terrier Pug
Genotype Color
CT
Black to tan points
CT
Black to silver
TT
Black to silver
TT
Golden and white
TT
Black and white
CC
Pigmented cream
CT
Red
CT
Cream dilute
CC
Silver fawn
CC
Red sable
CC
Red and white
CC
Black, red and white
CC
Sable with white
CC
Black and white
CC
Red
CC
Blue
TT
Grey, white and buff
TT
Grey and white
CC
Cream with brindle
CT
Pale gold
CT
Tan with black
CT
Sable and white
CC
Seal
CC
Wolf grey
CT
Cream
CC
Black and tan
CT
Black masked red
CT
Blue brindle domino
CC
Red and white
CC
Fawn, black mask
CT
White
TT
White
CC
Albino

HR Wijesena, SM Schmutz

File: a-mutation-in-the-slc45a2-gene-is-associated-with-albinism-in.pdf
Author: HR Wijesena, SM Schmutz
Author: SRILANKA
Published: Mon Jun 16 14:27:24 2014
Pages: 3
File size: 0.09 Mb


On the Road. 1957, 2 pages, 0.03 Mb

CURRICULUM VITAE for, 72 pages, 0.48 Mb

Tales of ten worlds, 4 pages, 0.04 Mb

Arms for Arbenz, 17 pages, 0.2 Mb
Copyright © 2018 doc.uments.com