Glucocorticoid receptor-mediated protection from apoptosis is associated with induction of the serine/threonine survival kinase gene, sgk-1, CA Mikosz, DR Brickley, MS Sharkey, TW Moran

Tags: glucocorticoid, apoptosis, dexamethasone, HA-SGK, sgk, cell lines, epithelial cells, mammary tumor cell, Cancer Research, SGK expression, mammary epithelial cells, growth factors, Amersham Pharmacia Biotech, cell survival, EGF stimulation, glucocorticoid receptor, mammary epithelial cell, Immunoprecipitated SGK, serine/threonine kinase, Boehringer Mannheim, TBS, breast cancer cells, Christina A. Mikosz, Department of Medicine University of Chicago, University of Chicago, transcriptional activity, transcriptional activation, epithelial cell survival, Siegfried Waldegger, antiapoptotic, cancer cell lines, Cancer Research Foundation Young Investigator, kinase activity, survival function, survival mechanism, alternative pathway, MEC cell lines, Stoney Simons, nitrocellulose membrane, cell lysates, apoptotic cells, monoclonal antibody, Nissim Hay, glucocorticoid treatment, serum-free media
Content: JBC Papers in Press. Published on February 13, 2001 as Manuscript M010842200
Glucocorticoid receptor-mediated protection from apoptosis is associated with induction of the serine/threonine survival kinase gene, sgk-1.
Christina A. Mikosz, Deanna R. Brickley, Melinda S. Sharkey, Timothy W. Moran and Suzanne D. Conzen1 Department of Medicine, Section of Hematology/Oncology, University of Chicago, Chicago, Illinois 60637
1To whom correspondence should be addressed at: Department of Medicine University of Chicago 5841 South Maryland Avenue, MC 2115 Chicago IL 60637 Tel: 773-834-2604 Fax: 773-834-0188 e-mail: [email protected] Key words: mammary epithelial cells, apoptosis, glucocorticoid receptor, sgk-1 Running Title: A novel survival pathway in mammary epithelial cells...
1
A novel survival pathway in mammary epithelial cells...
Copyright 2001 by The American Society for Biochemistry and molecular biology, Inc.
Summary We have previously demonstrated that activation of the glucocorticoid receptor (GR) initiates an antiapoptotic signal in the immortalized human mammary epithelial cell (MEC) line MCF10A that is dependent on the GR's transcriptional activity. In this study, we show that the survival role of GR activation extends to protecting human breast cancer cells undergoing apoptosis following growth factor deprivation. Serum-and-glucocorticoid-regulated kinase1 (sgk), a gene previously identified as a direct transcriptional target of the activated GR in a rat mammary tumor cell line, was rapidly induced following GR activation in human MECs. Furthermore, in the absence of all growth factors, ectopic sgk expression inhibited apoptosis, suggesting that sgk is a survival kinase. Finally, kinase-dead sgk expression inhibited the protection from apoptosis usually seen following GR activation. These findings suggest that sgk is an important downstream target of GR-mediated survival signaling and that it is distinct from other survival kinases because it can be primarily regulated at the level of transcription.
2
A novel survival pathway in mammary epithelial cells...
Introduction The specificity of the glucocorticoid receptor's (GR) transcriptional activity varies widely between cell types, thus accounting for glucocorticoid's diverse and sometimes opposite physiological effects in different tissues. For example, glucocorticoids have been shown to promote apoptosis in lymphocytes (1,2), while human mammary epithelial cells (MECs) (3) and rat hepatoma (HTC) epithelial cells (4) are protected from apoptosis following GR activation. Furthermore, studies in both breast and liver epithelial cells have demonstrated that RU486, a potent GR antagonist that inhibits GR-mediated transcriptional activation, reverses the survival effect of glucocorticoids (3,4). RU486's antagonistic effects on cell survival suggest that glucocorticoid-mediated survival is regulated specifically through GR-induced transactivation of downstream genes. Previous studies using glucocorticoid concomitantly with or without the GR's antagonist RU486 have suggested that the identification of genes directly induced or repressed by GR activation might reveal important pathways relevant to epithelial cell survival signaling. One such GR-inducible gene, serum-andglucocorticoid-regulated kinase-1 (sgk), is a serine/threonine kinase with 54% homology in its catalytic domain to the well-described antiapoptotic kinase akt. Sgk was originally identified through subtractive cloning of a serum and glucocorticoid-induced mammary tumor cell cDNA library (5). More recently, sgk
3
A novel survival pathway in mammary epithelial cells...
was found to be part of a larger gene family and was designated sgk-1 (6). Interestingly, sgk has also been shown to be transcriptionally induced following activation of a variety of steroid receptors including the mineralocorticoid receptor in kidney epithelial cells (7) and the follicle stimulating hormone receptor in ovarian granulosa cells (8). Sgk transcripts have also been shown to be induced following changes in cell volume (9) and under conditions of extracellular hyperosmotic stress (10). In this report, we have extended our original investigation of GR-mediated survival signaling from the nontumorigenic MEC cell line MCF10A to breast cancer cell lines. Although only a subset of commonly-studied human breast tumor cell lines undergo significant apoptosis following growth factor deprivation, most of these growth factor-dependent cell lines were protected from apoptosis following treatment with physiological concentrations of glucocorticoid. Furthermore, the effect of glucocorticoid appears to be GR-mediated because it can be outcompeted by high-affinity GR antagonists. We also demonstrate that the GR survival signal is likely to be transmitted at least in part as a consequence of the transcriptional activation of sgk, since: i) sgk mRNA is induced in a GR-dependent fashion immediately following glucocorticoid treatment of human MECs; ii) ectopic SGK expression protects MECs from apoptosis induced by growth factor withdrawal; and iii) expression of a kinase-dead SGK inhibits protection from
4
A novel survival pathway in mammary epithelial cells...
apoptosis. Taken together, these results suggest the existence of a novel GRinitiated antiapoptotic pathway that operates, at least in part, through transcriptional induction of the survival kinase, sgk.
Materials and Methods cDNA Constructs. pOG-hSGK was obtained as a generous gift from Dr. Siegfried Waldegger (University of Hamburg, Germany). The human sgk cDNA fragment was amplified from pOG and cloned into the EcoR1 and XhoI sites of the retroviral vector pLPCX (Clontech, Palo Alto, CA) by applying a PCR-based strategy that incorporated a hemaglutinnin (HA) tag in-frame in the amino terminus of wildtype sgk using the following primer (Gibco BRL, Grand Island, NY): wildtype HA-SGK 5TAATACTCGAGGCTCCATCATGTACCCATATGA CGTTCCAGACTACGCTACGGTGAAAACT-3. N60 HA-SGK was similarly constructed by inserting an HA tag in frame 5ґ to the coding sequence for amino acid 61 of SGK: N60 HA-SGK 5-GGAATTCCTAAGCGTAGTCTGGAACGT CATATGGGTATACCCCTGCATCAGT-3. The carboxy terminal primer for both constructs was: 5-GGAATTCCTCAGAGGAAAGAGTC-3. The PCR reaction mixtures were supplemented with 10% DMSO and run with Pfu DNA polymerase (Promega, Madison, WI) with an initial 95°C--5 min denaturation
5
A novel survival pathway in mammary epithelial cells...
followed by 35 cycles at 95°C--1 min, 55°C--1 min, 72°C--3 min and a final 72°C--5 min elongation. Mutations were confirmed using primers provided with the pLPCX vector by overlapping bidirectional sequencing using an ABI776 sequencer (Perkin Elmer, Wellesley, MA).
Cell Culture and viral infection. All parental cell lines were obtained from American Type Culture Collection (ATCC, Manassas, VA). MCF10A and MCF10A-Myc cells (as described in (3)) were cultured in a 1:1 mixture of DMEM and Ham's F12 (BioWhittaker, Walkersville, MD), supplemented with hydrocortisone (0.5 µg/ml), human recombinant EGF (10 ng/ml), and bovine insulin (5 µg/ml; Sigma Chemical Co., St. Louis, MO). BT-20, Hs578T, MDAMB-231, MDA-MB-468, SK-BR-3, and T-47D cells were cultured in DMEM (BioWhittaker) supplemented with 10% heat-inactivated fetal calf serum (FCS; Atlanta Biologicals, Norcross, GA). MCF7 cells were cultured in MEM (ATCC) supplemented with 10% heat-inactivated FCS, and HCC1937 cells were cultured in RPMI-1640 (BioWhittaker) supplemented with 10% heat-inactivated FCS. Retroviruses were made by transient transfection of retroviral vectors into amphotropic Phoenix cells (a gift of Dr. Gary Nolan, Stanford University, Palo Alto, CA) using either standard calcium phosphate precipitation or Effectene Transfection Reagent per manufacturer's instructions (Qiagen, Santa Clarita, CA).
6
A novel survival pathway in mammary epithelial cells...
MECs were infected as described previously (3) with HA-SGK-expressing retroviruses and clones were selected with puromycin (400ng/ml). Individual colonies were tested for HA-SGK expression by Western analysis using an antiHA monoclonal antibody.
Apoptosis Assays. Cells were trypsinized and seeded subconfluently at 1 x 105 cells per 3-cm well in the appropriate media. Cells were allowed to adhere overnight, rinsed twice with PBS, and subsequently cultured for 72 hours in serumfree media containing insulin, EGF, hydrocortisone, dexamethasone (10-6M), or combinations of these purified growth factors in the concentrations listed above. In GR antagonist assays, RU486 (5 x 10-7 M; Sigma Chemical Co., St. Louis, MO), dexamethasone 21-mesylate (DM, 10-7 M; Steraloids Inc, Newport, RI), and dexamethasone oxetanone (DexOx,10-5 M; a gift of Dr. Stoney Simons, NIH) were added to media containing glucocorticoid. In some experiments, cells were pre-treated for 30 minutes with serum-free media and 50µM LY294002 (Calbiochem, San Diego, CA) or vehicle alone (0.01% DMSO in PBS) followed by addition of appropriate growth factors. Following a 72 hour incubation, media and floating debris were gently aspirated from wells and replaced with two mls of fresh serum-free media; cells were then immediately fixed by adding 500µL of 37% formaldehyde to each well in a
7
A novel survival pathway in mammary epithelial cells...
dropwise fashion and incubating at room temperature for 30 min. The fixative solution was subsequently aspirated and fixed cells were allowed to dry overnight. To score for apoptosis, cells were then stained with a 1µM DAPI/PBS solution as described previously (11). A Nikon Eclipse E800 microscope with UV illumination at 600X magnification was used to count at least 200 DAPI-stained cells per well in order to determine the percentage of apoptotic cells per experimental condition. All apoptosis assays were repeated a minimum of three separate times to calculate averages and SEs.
Western Analysis. Equal numbers of cells (1 x 105) were cultured in 3cm dishes overnight. The following morning, cells were washed twice on ice with ice-cold PBS and lysed directly in 40 µl of 2X Laemmli buffer. Whole cell lysates were prepared by scraping cells with a rubber spatula, passing lysates ten times through an 18-gauge needle, and then boiling for five minutes. Samples were then electrophoresed in 8% or 9% SDS-PAGE gels and transferred to nitrocellulose (Osmonics, Minnetonka, MN). Equal protein loading was confirmed by visual inspection of Ponceau S staining of the nitrocellulose membrane. Nitrocellulose was then rinsed with Tris-buffered saline (TBS)/0.1% Tween and incubated with one of the following antibodies: rabbit polyclonal anti-GR (Affinity Bioreagents, Golden, CO) or rat monoclonal anti-HA (Boehringer Mannheim, Indianapolis, IN).
8
A novel survival pathway in mammary epithelial cells...
After primary antibody incubation and extensive washing with TBS/0.1% Tween, the appropriate secondary antibody--either anti-rabbit IgG-horseradish peroxidase (HRP) (Santa Cruz Biotechnology, Santa Cruz, CA) or anti-rat IgG-HRP (Sigma)--was added at a 1:5000 dilution. The nitrocellulose was washed again with TBS/0.1% Tween, incubated in ECL substrate according to manufacturer's instructions (Amersham Pharmacia Biotech, Piscataway, NJ), exposed to film, and developed. Blots were subsequently probed with a mouse Я-actin antibody (Sigma) or a mouse GAPDH antibody (Chemicon, Temecula, CA) as a loading control. Kinase Assay. MCF10A-Myc cells stably expressing various SGK constructs (see above) were lysed as described in (12). Two mgs of lysate measured by Bradford assay were then used to immunoprecipitate SGK. Specifically, lysates were incubated with rat monoclonal HA antibody-coated 4B Fast Flow protein G sepharose beads (Sigma) for 90 min at 4єC. Immunoprecipitated SGK was then used in a kinase assay as described in (12). Incorporation of [-32P] dATP into SGK-tide was counted on a Packard 2200CA gamma counter and the assay was repeated to obtain average [-32P] dATP incorporation.
9
A novel survival pathway in mammary epithelial cells...
Northern Analysis. MCF10A-Myc and MDA-MB-231 cells were trypsinized, seeded in equal numbers in 10cm dishes, and allowed to grow in the appropriate media. When cells reached ~80% confluency, media was aspirated, cells were washed twice with PBS and incubated in serum-deprived (0.5%FCS) media for 72 or 96 h. Following serum deprivation, cells were stimulated for 30 min with either vehicle alone (ETOH), dexamethasone, dexamethasone/RU486 or 20% FCS. Total RNA was harvested using the RNeasy Mini Kit per manufacturer's instructions (Qiagen, Santa Clarita, CA). RNA was quantified by spectrophotometry and 20µg of RNA per Experimental group was electrophoresed in a 1.0% agarose/17% formaldehyde gel, and then transferred onto Hybond nylon membranes (Amersham Pharmacia Biotech). Membranes were then sequentially hybridized with a full-length human sgk cDNA probe and a rat gapdh cDNA probe labeled with [-32P] dCTP using the Prime-It II Random Primer Labeling Kit (Stratagene, Cedar Creek, TX). Membranes were then washed and exposed to film. Bands were quantified using a Biorad GS-710 Calibrated Imaging Densitometer so that the relative ratio of sgk:gapdh signal could be determined. Experiments were repeated at least two times to calculate average ratios of sgk:gapdh mRNA intensities and SEs.
10
A novel survival pathway in mammary epithelial cells...
Site-Directed Mutagenesis. The kinase-dead mutation (K127M HA-SGK) and the phosphorylation site mutations (T256A and S422A HA-SGK) of HA-tagged hSGK were made using the QuikChange Site-Directed Mutagenesis kit (Stratagene) per manufacturer's instructions. Primers were synthesized to alter either hSGK's ATP-binding site, lysine127, to methionine or the putative phosphorylation sites threonine256 or serine422 of hSGK to alanine. Primers (Gibco BRL) consisted of the following sequences: K127M HA-SGK 5ґ-TTCTATGCAGTCATGGTTTTAA AGAAGAAAGCAATC-3ґ; T256A HA-SGK 5ґ-CACAACAGCACAACATCC GCATTCTGTGGCACGCCGGAG-3ґ; S422A HA-SGK 5ґ-GCCGAGGCTTTC CTGGGCTTTGCCTATGCGCCTCCC-3ґ (mutated codons underlined). The template DNA used was HA-tagged pLPCX-hSGK. Mutations were confirmed using primers provided with the pLPCX vector by bidirectional sequencing using an ABI776 sequencer (Perkin Elmer, Wellesley, MA). Mutant pLPCX-SGK vectors were then used to generate retroviruses and infect MECs as described above.
11
A novel survival pathway in mammary epithelial cells...
Results Glucocorticoids inhibit apoptosis of human breast cancer cells via activation of the GR. We previously demonstrated that GR activation initiates a potent antiapoptotic signal in the nontumorigenic MEC line MCF10A and its derivative line MCF10A-Myc. In the current study, we wished to determine whether GR activation might also inhibit apoptosis in breast cancer cell lines. We therefore selected eight commonly-studied breast cancer cell lines (BT-20, HCC1937, Hs578T, MCF7, MDA-MB-231, MDA-MB-468, SK-BR-3, and T-47D) and evaluated them for GR expression. western blot analysis of whole cell extracts using affinity-purified anti-human GR antibodies revealed that all eight cell lines expressed the GR protein (Fig. 1A), although as previously reported, the T-47D line had relatively little GR expression (13,14,15). To examine whether glucocorticoid treatment can mediate a survival pathway in these tumor cell lines, apoptosis was measured after 72 hours in the absence of all growth factors (including glucocorticoid) and in the presence of a physiological concentration (10-6 M) of the synthetic glucocorticoid dexamethasone. In the absence of all growth factors, the average percentage of apoptosis in breast cancer cell lines varied from 10.6% in MDA-MB-231 cells to only 0.6% in MCF7 cells (Fig. 1B). In four of the eight tumor cell lines
12
A novel survival pathway in mammary epithelial cells...
tested--MDA-MB-231, BT-20, Hs578T, and MDA-MB-468--treatment with dexamethasone significantly inhibited apoptosis when compared to complete growth factor deprivation (p < 0.05). To determine whether glucocorticoid-mediated survival was functioning specifically through activation of the GR, MCF10A-Myc and MDA-MB-231 cells were treated concomitantly with dexamethasone and one of three known antagonists of GR activation and its subsequent transcriptional activity: RU486 (5 x 10-7 M) (16), dexamethasone oxetanone (DexOx, 10-5M) (17), or dexamethasone 21-mesylate (DM, 10-7M) (18) (Fig. 2A). All three GR antagonists reversed the antiapoptotic effect of glucocorticoids significantly (p < 0.05), although to varying degrees depending on the cell line examined (Fig. 2B). In MCF10A-Myc cells, RU486 co-treatment was the most potent antagonist of glucocorticoid-mediated survival, resulting in a 4.5-fold increase in apoptosis. In MDA-MB-231 cells, however, DM was the most potent antagonist of survival signaling by glucocorticoid, resulting in a similar 4.5-fold increase in apoptosis at 72 hours compared with cells protected by glucocorticoid alone (Fig. 2B). As expected for a receptor-mediated mechanism of glucocorticoid activation, the effect of all three GR antagonists could be outcompeted in MCF10A-Myc cells (Fig. 2C) and MDAMB-231 cells (data not shown) with increasing concentrations of dexamethasone.
13
A novel survival pathway in mammary epithelial cells...
Taken together, these results suggest that glucocorticoid-mediated survival in breast cancer cell lines is mediated specifically through the activation of the GR.
Inhibition of apoptosis following GR activation correlates with transcriptional induction of the immediate early response gene, sgk. We next sought to define the survival mechanism downstream of GR activation. Using a commercial human cancer array blot spotted with 1200 genes (Clontech, Palo Alto, CA), we compared gene expression represented by reverse transcription of mRNA from MCF10A cells treated for 30 minutes with either vehicle alone (ETOH), dexamethasone (10-6M) or both dexamethasone (10-6 M) and RU486 (10-7M). We identified several genes that were induced or repressed at least two-fold by 30 minutes of glucocorticoid treatment but whose expression was not changed following concomitant treatment with the GR antagonist RU486 (data not shown). One of the most intriguing GR-induced genes identified from this differential display of MEC transcripts was sgk, a putative serine/threonine kinase previously shown to be 54% homologous in its catalytic domain to the wellcharacterized antiapoptotic serine/threonine kinase akt (5). Although sgk had been shown to be transcriptionally induced by glucocorticoid treatment in rat mammary carcinoma cells (5), another study found that sgk transcripts were not induced by glucocorticoid treatment in human kidney epithelial cells (9). This raised the
14
A novel survival pathway in mammary epithelial cells...
possibility of a species-specific difference in sgk promoter activation by glucocorticoids. Therefore, we first confirmed our array data using Northern analysis of sgk mRNA transcripts expressed 30 minutes following glucocorticoid treatment in two glucocorticoid-sensitive human breast cell lines, MCF10A-Myc and MDA-MB-231. Northern blot analysis of total cellular mRNA using an -32Plabeled full-length human sgk cDNA probe demonstrated that in MCF10A-Myc cells, GR activation significantly induced sgk mRNA (Fig. 3A). The GR antagonist RU486 inhibited sgk mRNA induction, while gapdh transcript expression remained relatively constant under all conditions. MDA-MB-231 cells had a similar, although slightly less robust, induction of sgk transcripts following glucocorticoid treatment that was also abrogated by concomitant RU486 treatment (Fig. 3B). In both cell types, serum stimulation induced sgk transcripts. These data suggest that glucocorticoid stimulation of human MECs appears to directly induce sgk expression through a GR-dependent mechanism that can be antagonized by RU486.
Ectopic overexpression of wildtype sgk inhibits apoptosis. We next investigated the biological activity of ectopically-expressed SGK in MCF10A-Myc cells subjected to apoptotic stress. SGK was ectopically expressed in MCF10A-Myc cells following transduction with retroviruses encoding either a
15
A novel survival pathway in mammary epithelial cells...
hemaglutinnin (HA)-tagged wildtype human sgk (HA-sgk) or a truncated HAtagged sgk containing amino acids 61-431 (N60 HA-sgk). The truncated N60 SGK protein had been previously shown to be more efficiently expressed than wildtype SGK in human embryonic kidney (HEK) 293 cells (6). Individual clones expressing either wildtype HA-SGK or N60 HA-SGK were isolated by puromycin selection, and whole cell lysates were examined for HA-SGK protein expression by Western analysis using a monoclonal anti-HA antibody. Similar to previously-reported results in HEK 293 cells, N60 HA-SGK was much more efficiently expressed than the full-length, wildtype HA-SGK, although both were clearly visible in comparison to cells transduced with the empty retroviral pLPCX vector alone (Fig. 4A). In order to determine whether wildtype and N60 HA-SGK have kinase activity when overexpressed, MCF10A-Myc cells stably expressing these two constructs were deprived of all growth factors overnight and SGK activity was measured. Figure 4B presents the kinase activity of SGK immunoprecipitated from wildtype HA-SGK, N60 HA-SGK, and a kinase-dead K127M HA-SGK expressed in MCF10A-Myc cells. Since an efficient substrate for SGK kinase activity is not known, we used the previously-described "SGK-tide" as a substrate (12). Elevated kinase activity was seen in both wildtype and N60 HASGK immunoprecipitated from MCF10A-Myc cells when compared to K127M HA-SGK. Immunoprecipitated wildtype and N60 HA-SGK both appeared as a
16
A novel survival pathway in mammary epithelial cells...
doublet in Western analysis, suggesting that phosphorylated forms of SGK exist in MCF10A-Myc cells despite the absence of growth factors in the culture medium. SGK-overexpressing MCF10A-Myc cell lines were then evaluated for apoptosis following various conditions of growth factor deprivation. In the absence of all growth factors (Fig. 4C), both wildtype and N60 HA-SGKexpressing cell lines showed an average of ~60% inhibition of apoptosis compared to control cells expressing only the empty pLPCX vector. These results suggest that even in the absence of growth factors, expression of either the wildtype or truncated N60 HA-SGK can protect MECs from apoptosis. Interestingly, the addition of insulin and EGF (shown previously in MCF10A cells to stimulate the PI-3-kinase pathway sufficiently to induce AKT phosphorylation [3]) did not significantly increase survival in cells expressing ectopic SGK. The antiapoptotic activity of SGK in the absence of EGF or insulin stimulation was somewhat surprising because SGK activation has been shown previously to be dependent on the insulin-stimulated PI-3-kinase signaling pathway (12). In order to determine whether the survival effect observed following overexpression of wildtype SGK in fact requires SGK kinase activity, we examined the antiapoptotic activity of two "kinase-dead" mutant SGK proteins, K127M HA-SGK and T256A/S422A HA-SGK, a double mutation of the conserved second-messenger phosphorylation residues in SGK (12). These
17
A novel survival pathway in mammary epithelial cells...
constructs were used to make stable MCF10A-Myc cell lines (Fig. 5A). Earlypassage kinase-dead mutant HA-SGK cell lines were then evaluated in apoptosis assays. In contrast to wildtype, neither kinase-dead HA-SGK provided significant protection from apoptosis under conditions of serum withdrawal (Fig. 5B). These results suggest that SGK kinase activity is in fact essential for its antiapoptotic function. We next asked whether kinase-dead SGK could act as a functional dominant negative construct and inhibit survival in MECs treated with glucocorticoid. Cell lines overexpressing K127M HA-SGK were deprived of all growth factors or treated with dexamethasone (10-6 M) alone for 72 hours. In K127M HA-SGKexpressing cell lines treated with glucocorticoid, a small but consistent increase in apoptosis was seen when compared to the parental cell line (Fig. 5C). These results suggest that the survival effect seen following glucocorticoid induction of SGK can be partially abrogated by the presence of kinase-dead SGK, implying a possible dominant negative function for kinase-dead SGK.
The PI-3-kinase pathway is required for SGK's survival function. The absence of a requirement for either insulin or EGF stimulation in conjunction with wildtype SGK overexpression suggested that in our system either A) an alternative pathway to PI-3-kinase signaling was upstream of SGK
18
A novel survival pathway in mammary epithelial cells...
activation, or B) endogenous PI-3-kinase activity was sufficient to activate SGK. To determine whether PI-3-kinase activity was in fact required for SGK's antiapoptotic function, we treated SGK-overexpressing cells with LY294002 (50µM), a PI-3-kinase-specific inhibitor. Pretreatment of MEC lines with LY294002 resulted in a statistically-significant increase in the percentage of apoptosis in both wildtype HA-SGK and N60 HA-SGK-expressing cells, but not in control (pLPCX alone) cells (Fig. 6). These results suggest that PI-3-kinase signaling is indeed required for SGK's survival activity and indicate that endogenous PI-3-kinase activity in MECs appears to be sufficient to activate SGK, even in the absence of insulin and EGF stimulation.
Discussion We have identified a novel pathway of mammary cell survival that operates via GR activation in both nontumorigenic MECs and breast cancer cell lines. The relationship between GR activation and several induced and repressed genes was evaluated by array analysis. One of the GR-induced genes, sgk, is a known serumand-glucocorticoid-regulated kinase with strong homology in its catalytic domain to the catalytic domain of the antiapoptotic kinase akt (5). In a panel of MEC cell lines, MCF10A-Myc cells and MDA-MB-231 cells were found to be most
19
A novel survival pathway in mammary epithelial cells...
sensitive to growth factor withdrawal-induced apoptosis and also demonstrated the lowest endogenous levels of SGK expression (data not shown). Glucocorticoid treatment of these cell lines significantly induced sgk mRNA and resulted in survival. Furthermore, ectopically-expressed SGK blocked cell death following growth factor withdrawal, but overexpression of a kinase-dead SGK did not protect cells from apoptosis. The induction of sgk mRNA resulting from glucocorticoid treatment suggests an important transcriptional control mechanism for the activity of this protein. This finding provides a novel model of kinase activation that appears partially independent of cell surface growth factor receptor signaling. However, the downstream targets of SGK kinase activity remain to be identified. Interestingly, although sgk expression in HEK 293 cells has been shown to be regulated by reversible PI-3-kinase-dependent phosphorylation (6,12), our results suggest that endogenous PI-3-kinase activity may be sufficient to activate sgk. One possibility is that endogenous PDK-1 activity, a downstream target of PI3-kinase, is particularly high in MECs. Alternatively, a parallel PDK-1-like kinase may be responsible for SGK activation in these cells. A third possible explanation is that human MECs may express mutated or low-activity phosphatases that would otherwise reverse endogenous PI-3-kinase activity. The mechanism through which SGK prevents apoptosis remains unknown. However, in kidney epithelium, SGK has been demonstrated to be a target of
20
A novel survival pathway in mammary epithelial cells...
aldosterone-induced regulation of electrogenic sodium absorption (7,19,20), implicating SGK in the control of intracellular fluid volume. Since cell shrinkage is known to be an early hallmark of apoptosis (21), SGK expression may counteract the early changes in cell volume that precede apoptosis by controlling intracellular fluid shifts. The possibility that SGK may exert its antiapoptotic effects by regulating cation channels and maintaining intracellular volume is the subject of future investigation. In summary, we have identified GR activation as initiating a potent survival signal in both immortalized and malignant human breast epithelial cells. Sgk, a novel member of the second-messenger family of serine/threonine protein kinases, has been identified as a probable downstream effector of GR survival signaling. Regulation of SGK's antiapoptotic activity in breast epithelial cells was found to be largely independent of insulin or EGF stimulation, although PI-3-kinase activity is required. Furthermore, transcriptional control of SGK expression appears to be the dominant mechanism of induction of SGK activity, suggesting a novel interaction between steroid hormone receptor activation and serine/threonine kinase-mediated survival.
Acknowledgements: We thank Dr. Stoney Simons for generously supplying dexamethasone oxetanone, Dr. Siegfried Waldegger for the human sgk cDNA,
21
A novel survival pathway in mammary epithelial cells...
Renee Simon for assistance in generating cell lines, Robert Nash for help with array analysis, and Drs. Marsha Rosner, Clive Palfrey and Nissim Hay for useful discussions. We also thank the DNA Sequencing Facility of the University of Chicago.
Footnotes: This work was supported in part by NIH Grant R21 CA66132 from the National Cancer Institute, The National Women's cancer research Alliance, a Cancer Research Foundation Young Investigator's Award to S.D.C. and The Susan G. Komen Foundation. The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. References 1. Wyllie, A. (1980) Nature 284, 555-556. 2. Schwartzman, R., and Cidlowski, J. (1994) Int Arch Allergy Immunol 105(4), 347-54. 3. Moran, T., Gray, S., Mikosz, C., and Conzen, S. (2000) Cancer Research 60(4), 867-872. 4. Evans-Storms, R., and Cidlowski, J. (2000) Endocrinology 141(5), 1854-62. 5. Webster, M., Goya, L., Ge, Y., Maiyar, A., and Firestone, G. (1993) Mol Cell Biol 13(4), 2031-2040. 6. Kobayashi, T., and Cohen, P. (1999) Biochem J 339, 319-328. 7. Naray-Fejes-Toth, A., Canessa, C., Cleaveland, E., Aldrich, G., and FejesToth, G. (1999) J Biol Chem 274(24), 16973-16978. 8. Alliston, T., Maiyar, A., Buse, P., Firestone, G., and Richards, J. (1997) Mol Endocrinol 11(13), 1934-49. 9. Waldegger, S., Barth, P., Raber, G., and Lang, F. (1997) PNAS 94(9), 44405. 10. Bell, L., Leong, M., Kim, B., Wang, E., Park, J., Hemmings, B., and Firestone, G. (2000) J Biol Chem 275(33), 25262-25272.
22
A novel survival pathway in mammary epithelial cells...
11. Kennedy, S., Wagner, A., Conzen, S., Jordan, J., Bellacosa, A., Tsichlis, P., and Hay, N. (1997) Genes Dev. 11, 701-713. 12. Park, J., Leong, M., Buse, P., Maiyar, A., Firestone, G., and Hemmings, B. (1999) Embo 18(11), 3024-3033. 13. Horwitz, K., Zava, D., Thilagar, A., Jensen, E., and McGuire, W. (1978) Cancer Research 38, 2434-2437. 14. Wu, K., and Pfahl, M. (1988) Mol Endo 2(12), 1294-1301. 15. Nordeen, S., Kuhnel, B., Lawler-Heavner, J., Barber, D., and Edwards, D. (1989) Mol Endo 3(8), 1270-8. 16. Cairns, C., Cairns, W., and Okret, S. (1993) DNA Cell Biol 12, 695-702. 17. Lamontagne, N., Mercier, L., Pons, M., Thompson, E., and Simons, S. J. (1984) Endocrinology 114(6), 2252-63. 18. Richard-Foy, H., Sistare, F., Riegel, A., Simons, S. J., and Hager, G. (1987) Mol Endocrinology 1(9), 659-65. 19. Chen, S., Bhargava, A., Mastroberardino, L., Meijer, O., Wang, J., Buse, P., Firestone, G., Verrey, F., and Pearce, D. (1999) Proc Natl Acad Sci USA 96(5), 2514-9. 20. Shigaev, A., Asher, C., Latter, H., Garty, H., and Reuveny, E. (2000) Am J Physiol Renal Physiol 278(4), F613-9. 21. Kerr, J., Wyllie, A., and Currie, A. (1972) Br J Cancer 26, 239-257.
23
A novel survival pathway in mammary epithelial cells...
Legends Figure 1. Glucocorticoid protects MCF10A-Myc, MCF10A, and a subset of breast tumor cell lines from apoptosis. A, Western analysis of GR expression in MCF10A cells and a panel of breast cancer cell lines. B, Percentage of apoptotic MCF10A-Myc, MCF10A, and breast cancer cells following 72 hours of growth factor deprivation in the presence or absence of dexamethasone (10-6 M) (*= p < 0.05, one-sided T-test, indicating significantly less apoptosis in the presence of dexamethasone [10 ­6 M]). Error bars indicate standard error of the mean (S.E.M.).
Figure 2. Glucocorticoid-mediated protection from apoptosis in MECs is abrogated following antagonism of the GR. A, Chemical structures of dexamethasone and the GR antagonists RU486, dexamethasone 21-mesylate (DM), and dexamethasone oxetanone (DexOx). B, Percentage of apoptotic MCF10A-Myc and MDA-MB-231 cells following treatment for 72 hours with dexamethasone (10-6M) and each one of three GR antagonists (**= p < 0.05 for MCF10A-Myc and *= p < 0.05 for MDA-MB-231 cells, indicating significantly more apoptosis with concomitant RU486 [10-7 M], DexOx [10-5M], and DM [107M] treatment compared with dexamethasone alone). C, Percentage of apoptotic MCF10A-Myc cells in the presence of GR antagonists and increasing concentrations of dexamethasone. All error bars indicate S.E.M.
24
A novel survival pathway in mammary epithelial cells...
Figure 3. Sgk transcripts are immediately induced in MECs following GR activation. Representative Northern analysis of sgk mRNA induction in A, MCF10A-Myc cells and B, MDA-MB-231 cells following a 30-min treatment with dexamethasone (10-6 M), dexamethasone (10-6 M)/RU486 (10-7 M), or 20% FCS. The average ratios of sgk mRNA expression to gapdh mRNA expression are shown as a bar graph below the Northern analysis, presented as the fold induction over baseline sgk/gapdh levels. All error bars indicate S.E.M. Figure 4. Ectopic expression of SGK inhibits cell death following growth factor withdrawal. A, Anti-HA Western analysis confirming ectopic HA-SGK expression of both wildtype and N60 HA-SGK clones in MCF10A-Myc cells. B, Relative kinase activity using SGK-tide as a substrate (12) of both wildtype-HASGK and N60-HA-SGK versus K127M (kinase-dead) HA-SGK. Anti-HA immunoprecipitation followed by Western analysis confirming ectopic HA-SGK expression in MCF10A-Myc cells is shown below bar graph. C, Percentage of apoptosis following 72 hours of growth factor deprivation, in either the absence of all growth factors or in the presence of insulin and EGF but no glucocorticoid, in wildtype HA-SGK-expressing and N60-HA-SGK-expressing MCF10A-Myc
25
A novel survival pathway in mammary epithelial cells...
clones compared with MCF10A-Myc cells expressing only the empty pLPCX vector. All error bars indicate S.E.M. Figure 5. Kinase-dead mutants of wild-type SGK are defective in protecting from apoptosis. A, Anti-HA Western analysis confirming ectopic mutant HASGK expression in MCF10A-Myc cells. B, Percentage of apoptosis in MCF10AMyc cells expressing a kinase-dead HA-SGK (either the ATP-binding mutant K127M HA-SGK or the double phosphorylation site mutant T256A/S422A HASGK) in comparison to cells expressing wildtype HA-SGK or the empty pLPCX vector alone. Cells were cultured either without all growth factors or in the presence of insulin and EGF but no glucocorticoid. C, Fold increase in apoptosis (+/- dexamethasone) of two MCF10A-Myc K127M HA-SGK clones in comparison to the parental cell line. All error bars indicate S.E.M. Figure 6. PI-3-kinase inhibition reverses the protective effect of ectopicallyexpressed SGK. Percentage of apoptosis after 72 hours of growth factor deprivation in MCF10A-Myc cells expressing either wildtype HA-SGK, N60HA-SGK, or the empty pLPCX vector with or without a 30-minute pretreatment with the specific PI-3-kinase inhibitor LY294002 (50µM; *= p < 0.05, indicating
26
A novel survival pathway in mammary epithelial cells...
significantly more death with LY294002 treatment compared with 0.01% DMSO/PBS vehicle alone; N.S. = not significant). All error bars indicate S.E.M.
27
A novel survival pathway in mammary epithelial cells...
A GR
HCC1937HS578T MCF7
MDA-MBM-2D3A1-MBS-K46B8R3 T47D
MCF10A BT20
B 35 30 25
No Growth Factors +Dexamethasone Only
% Apoptosis
20
15
10
5* ** ** 0
MCF10A/ MCF MDA-MB- BT-20 Hs
Myc
10A
231
578T
HCC 1937
*
MDAMB468
SK-BR-3 T-47D
MCF7
Fig. 1
A
Dexamethasone C H2O H O
HO
OH
Dexamethasone 21-Mesylate HO
C H2O S O2C H3 O OH
F O Dexamethasone O Oxetanone HO
O
H3C
C H3 N
O
F O O
F
RU486
OH C C C H3
B
% Apoptosis
35
MCF10A-Myc
30
25
MDA-MB-231
20
*
15
* **
10
**
5
0
+Dex
+Dex/
+Dex/
alone +DexOx +RU486
* ** +Dex/ DM
C
Fig. 2
A B
SGK
Vehicle+Dex +Dex/RU+42806% FCS
GAPDH
Fold SGK/GAPDH Induction (MCF10A-Myc)
3.2 3.0 2.8 2.6 2.4 2.2 2.0 1.8 1.6 1.4 1.2 1.0 0.8
No Growth Factors
+Dex
+Dex/ RU486
+20% FCS
SGK
Vehicle+Dex +Dex/RU+2408%6 FCS
GAPDH
Fold SGK/GAPDH Induction (MDA-MB-231)
2.2
2.0
1.8
1.6
1.4
1.2
1.0
0.8
No Growth Factors
+Dex
+Dex/ RU486
+20% FCS
Fig. 3
A 50kD
X C pLP
T W (#
9HDA)-SWG( T#K1H0AD-)SNGHK6A0-SGKN(H#6A10-ES)GK(#8E)
HA-SGK N60 HA-SGK
B
Relative Kinase Activity (SGK-tide)
6 5 4 3 2 1 0 1 N 6 0 W T K127M HA-SGK0HA-SGK HA-SGK
N 6 0 HA-SGK WT HA-SGK K127M HA-SGK
% Apoptosis
C 45 40 35 30 25 20 15 10 5 0
pLPCX
WT HA-SGK (#9D)
No Growth Factors No Glucocorticoid (+Insulin and EGF) +Glucocorticoid Only
WT HA-SGK (#10D)
N 6 0 HA-SGK (#1E)
N 6 0 HA-SGK (#8E)
Fig. 4
A 50kD
B
45 40
% Apoptosis
35
30
25
20
15
10
No Growth Factors + Insulin and EGF (No Glucocorticoid)
Fold Increase in Apoptosis
C
10 8 6 4 2 0 No growth factors +Dex (1µM)
+K127M HA-SGK (#1) +K127M HA-SGK (#7)
Fig. 5
% Apoptosis
N.S.
45
*
40
*
35
30 25
20
15
10
5
0
WT
N 6 0
pLPCX
HA-SGK
HA-SGK
No LY294002 +LY294002 (50µM)
Fig. 6

CA Mikosz, DR Brickley, MS Sharkey, TW Moran

File: glucocorticoid-receptor-mediated-protection-from-apoptosis-is.pdf
Author: CA Mikosz, DR Brickley, MS Sharkey, TW Moran
Author: SuzanneLab
Published: Thu Nov 30 17:37:34 2000
Pages: 33
File size: 2.02 Mb


, pages, 0 Mb

Polymer handbook, 6 pages, 0.29 Mb

Crossing the chasm, 61 pages, 1.68 Mb

Al-Tusi, connaissez-vous, 12 pages, 0.42 Mb
Copyright © 2018 doc.uments.com